plot_cgr.Rd

% Generated by roxygen2: do not edit by hand
% Please edit documentation in R/cgrplot.R
\name{plot_cgr}
\alias{plot_cgr}
\title{Plot CGR with customization options}
\usage{
plot_cgr(seq_index, main = NULL, cex = 0.2, pch = 4, col = "black", ...)
}
\arguments{
\item{seq_index}{Integer. The index of the sequence to plot.}

\item{main}{Character. Main title for the plot. If NULL, uses sequence name.}

\item{cex}{Numeric. Point size (default 0.2 for dense sequences).}

\item{pch}{Integer. Point character type (default 4 for crosses).}

\item{col}{Character. Color for points (default "black").}

\item{...}{Additional arguments passed to plot().}
}
\value{
NULL. Creates a plot as a side effect.
}
\description{
A convenience wrapper function to create a CGR plot with sensible defaults.
}
\examples{
assign("fasta_filtered", list(seq1 = "ATCGATCGATCGATCGATCG"), envir = .GlobalEnv)
plot_cgr(1)
plot_cgr(1, main = "My Sequence", col = "blue", cex = 0.3)
rm(fasta_filtered, envir = .GlobalEnv)

}