Check Documentation
I have checked the following places for your error:
Description of the bug
Preprocessed reads are not saved in results directory, even though preprocessing_savepreprocessedreads = true in config.
Steps to reproduce
Steps to reproduce the behaviour:
- Command line:
nextflow run nf-core/eager -c $EAGER_CONFIGS/CAAMP_profiles_v3.config -profile mjolnir_globe,CAAMP_mapQ0 -r dev --max_cpus $SLURM_CPUS_PER_TASK --input $WORKDIR/Syncerus_caffer_samplesheet.tsv --fasta_sheet $WORKDIR/Syncerus_caffer_refsheet.tsv --outdir $WORKDIR/Syncerus_caffer/step1_eager
- See error: No error message.
Expected behaviour
Preprocessed reads (fastq files) should appear in preprocessing/fastp/data.
Currently only see a preprocessing/fastp/stats directory.
Log files
Have you provided the following extra information/files:
System
- Hardware: HPC
- Executor: Slurm
- OS: Red Hat Enterprise Linux
- Version: 8.10 (Ootpa)
Nextflow Installation
Container engine
- Engine: Singularity
- version: 3.8.7
- Image tag: not sure where to get this info, but nfcore/eager:dev I think?
Additional context
Uploaded three log files, as I think .1.log or .2.log did the actual read processing, whereas the latest .log was for a resumed run where I changed from damageprofiler to mapdamage (java heap space issues, don't worry about it here).
.nextflow.log
.nextflow.log.2.log
.nextflow.log.1.log
My custom config:
profiles {
CAAMP_mapQ0 {
params {
// Profile description
config_profile_description = 'This is step 1 in the Circular Assembly of Ancient Mitogenomes Pipeline (CAAMP). Parameters for circular mapping of ancient DNA reads to a concatenated reference, including the reference mitogenome (competitive mapping), using bwa aln via CircularMapper. This uses a mapping quality of 0, which is required by the next program to be used, COMFRT, which recovers reads aligned to multiple scaffolds by bwa.'
config_profile_contact = 'Deon de Jager (dejager4@gmail.com)'
// Params to set on the command-line (specific to species): nextflow run nf-core/eager -c $EAGER_CONFIGS/CAAMP_profiles_v3.config -profile mjolnir_globe,CAAMP_mapQ0 -r dev --max_cpus $SLURM_CPUS_PER_TASK --input $WORKDIR/Syncerus_caffer_samplesheet.tsv --fasta_sheet $WORKDIR/Syncerus_caffer_refsheet.tsv --outdir $WORKDIR/Syncerus_caffer/step1_eager
// Preprocessing
//complexity_filter_poly_g = true // Not currently a listed option in v3
preprocessing_tool = 'fastp'
preprocessing_excludeunmerged = true
preprocessing_adapter1 = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' // Standard Illumina Truseq (default)
preprocessing_adapter2 = 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA' // Standard Illumina Truseq (default)
preprocessing_minlength = 30
preprocessing_savepreprocessedreads = true
// clip_min_read_quality = 20 // Not currently a listed option in v3
// preserve5p = true // Only for AdapterRemoval. Disables quality based trimming of collapsed reads, since both ends of these are informative for PCR duplicate filtering
// Mapping
mapping_tool = 'circularmapper'
mapping_bwaaln_n = 0.01 // aDNA parameter (default)
mapping_bwaaln_l = 1024 // aDNA parameter (default)
mapping_bwaaln_o = 2 // aDNA parameter (default)
mapping_circularmapper_circularfilter = false // Retain reads that do not map to the circular target chromosome (and also retain non-circular chromosome headers). Required for COMFRT.
// BAM Filtering
run_bamfiltering = true // default
bamfiltering_mappingquality = 0 // Explicitly specify a mapping quality of 0.
bamfiltering_retainunmappedgenomicbam = true // Keep unmapped reads in bam file (I think maybe COMFRT uses them for stats).
// Deduplication
deduplication_tool = 'markduplicates'
deduplication_skipregionsplit = true // run deduplication without splitting bams by contig.
// Damage Manipulation
run_trim_bam = false // Explicitly switch off bam trimming (this is the default). (Will only run on non-UDG or half-UDG libraries.)
// (aDNA) Damage Analysis
damagecalculation_tool = 'mapdamage' // was damageprofiler in the older two log files.
damagecalculation_mapdamage_downsample = 500000
// Feature Annotation Statistics
run_bedtools_coverage = true // BED file for mitogenome provided in refsheet.tsv under bedtools_feature_file field
}
}
}
Check Documentation
I have checked the following places for your error:
- nf-core/eager FAQ/troubleshooting can be found here
Description of the bug
Preprocessed reads are not saved in results directory, even though
preprocessing_savepreprocessedreads = truein config.Steps to reproduce
Steps to reproduce the behaviour:
nextflow run nf-core/eager -c $EAGER_CONFIGS/CAAMP_profiles_v3.config -profile mjolnir_globe,CAAMP_mapQ0 -r dev --max_cpus $SLURM_CPUS_PER_TASK --input $WORKDIR/Syncerus_caffer_samplesheet.tsv --fasta_sheet $WORKDIR/Syncerus_caffer_refsheet.tsv --outdir $WORKDIR/Syncerus_caffer/step1_eagerExpected behaviour
Preprocessed reads (fastq files) should appear in
preprocessing/fastp/data.Currently only see a
preprocessing/fastp/statsdirectory.Log files
Have you provided the following extra information/files:
.nextflow.logfileSystem
Nextflow Installation
Container engine
Additional context
Uploaded three log files, as I think
.1.logor.2.logdid the actual read processing, whereas the latest.logwas for a resumed run where I changed fromdamageprofilertomapdamage(java heap space issues, don't worry about it here)..nextflow.log
.nextflow.log.2.log
.nextflow.log.1.log
My custom config: